Mouse Neuroblastoma Cell Line (N2a[TRb1]-Dnmt3a-Cat Domain KO Clone 7)

Neuro2A[TRb1] mouse neuroblastoma cell line stably expressing human thyroid hormone receptor beta 1 with mutations introduced into the catalytic domain of DNA methyltransferase 3A (Dnmt3a) by CRISPR/Cas9 genome editing.

From the laboratory of Robert J. Denver, PhD, University of Michigan.

Catalog Number Product DataSheet Size AVAILABILITY Price Qty
EMU055
Mouse Neuroblastoma Cell Line (N2a[TRb1]-Dnmt3a-Cat Domain KO Clone 7)
1 Vial In stock
Regular Price:$580.00
On Sale:
Specifications

Product Type: Cell Line
Name: N2a[TRb1]-Dnmt3a-Cat Domain KO Clone 7
Cell Type: Neuron
Morphology: Neuronal
Organism: Mouse
Source: Mouse neuroblastoma
Biosafety Level: BSL1
Growth Conditions: DMEM/F12 supplemented with hygromycin B (500 ug/mL) and 10% fetal bovine serum stripped of thyroid hormone.
Subculturing: Can be passaged with trypsin per standard protocols
Cryopreservation: DMEM/F12 growth medium with 10% DMSO
Comments: The Dnmt3a gene encoding the catalytic domain was targeted using CRISPR/Cas9 genome editing gRNA: CCTGGAACTGCTACATGTGCGGGCATAAGGGCAC
Storage: LN2
Shipped: Dry Ice

Provider
From the laboratory of Robert J. Denver, PhD, University of Michigan.
References

If you publish research with this product, please let us know so we can cite your paper.

Loading...