Mouse Neuroblastoma Cell Line (N2a[TRb1]-Dnmt3a-Cat Domain KO Clone 7)
![Mouse Neuroblastoma Cell Line (N2a[TRb1]-Dnmt3a-Cat Domain KO Clone 7)](https://www.kerafast.com/MediaStorage/Product/Images/Large/3570_2001202001281435690.jpg "Mouse Neuroblastoma Cell Line (N2a[TRb1]-Dnmt3a-Cat Domain KO Clone 7)")
Neuro2A[TRb1] mouse neuroblastoma cell line stably expressing human thyroid hormone receptor beta 1 with mutations introduced into the catalytic domain of DNA methyltransferase 3A (Dnmt3a) by CRISPR/Cas9 genome editing.
From the laboratory of Robert J. Denver, PhD, University of Michigan.
Neuro2A[TRb1] mouse neuroblastoma cell line stably expressing human thyroid hormone receptor beta 1 with mutations introduced into the catalytic domain of DNA methyltransferase 3A (Dnmt3a) by CRISPR/Cas9 genome editing.
From the laboratory of Robert J. Denver, PhD, University of Michigan.
Specifications
| Product Type: | Cell Line |
| Name: | N2a[TRb1]-Dnmt3a-Cat Domain KO Clone 7 |
| Cell Type: | Neuron |
| Morphology: | Neuronal |
| Organism: | Mouse |
| Source: | Mouse neuroblastoma |
| Biosafety Level: | BSL1 |
| Growth Conditions: | DMEM/F12 supplemented with hygromycin B (500 ug/mL) and 10% fetal bovine serum stripped of thyroid hormone. |
| Subculturing: | Can be passaged with trypsin per standard protocols |
| Cryopreservation: | DMEM/F12 growth medium with 10% DMSO |
| Comments: | The Dnmt3a gene encoding the catalytic domain was targeted using CRISPR/Cas9 genome editing gRNA: CCTGGAACTGCTACATGTGCGGGCATAAGGGCAC |
| Storage: | LN2 |
| Shipped: | Dry Ice |
Provider
From the laboratory of Robert J. Denver, PhD, University of Michigan.
References
If you publish research with this product, please let us know so we can cite your paper.
