pCAG-p65AD-GBP6 Plasmid
pCAG-p65AD-GBP6 is used along with pCAG-Gal4DBD-10 gly-GBP1 to activate UAS-regulated genes in cells expressing GFP. The vector allows the exchange of activation domain (AD) or other proteins fused to the N-terminal end of GBP6 in the vector.
Green fluorescent protein (GFP) and its derivatives are commonly used markers of gene expression across model organisms. Notably, in the mouse, thousands of transgenic GFP lines have been generated; these reagents revealed the expression pattern of many genes and serve as reagents for labeling specific cell types. To extend the utility of transgenic GFP lines such that one can use GFP to directly manipulate any desired gene in the GFP-labeled cell types, we developed a synthetic system that uses GFP as a scaffold protein for inducing formation of a hybrid transcription factor. Recognition of GFP is mediated by GFP binding proteins (GBPs), which are single-chain GFP-binding domains derived from Camelid antibodies. Specific pairs of GBPs are capable of bringing together tethered DNA binding domain (DBD) and activation domain (AD) onto the GFP scaffold. Such a complex can then trigger induction of any gene regulated by an upstream activating sequence (UAS).
From the laboratory of Connie L. Cepko, PhD, Harvard University.
Part of The Investigator's Annexe program.
pCAG-p65AD-GBP6 is used along with pCAG-Gal4DBD-10 gly-GBP1 to activate UAS-regulated genes in cells expressing GFP. The vector allows the exchange of activation domain (AD) or other proteins fused to the N-terminal end of GBP6 in the vector.
Green fluorescent protein (GFP) and its derivatives are commonly used markers of gene expression across model organisms. Notably, in the mouse, thousands of transgenic GFP lines have been generated; these reagents revealed the expression pattern of many genes and serve as reagents for labeling specific cell types. To extend the utility of transgenic GFP lines such that one can use GFP to directly manipulate any desired gene in the GFP-labeled cell types, we developed a synthetic system that uses GFP as a scaffold protein for inducing formation of a hybrid transcription factor. Recognition of GFP is mediated by GFP binding proteins (GBPs), which are single-chain GFP-binding domains derived from Camelid antibodies. Specific pairs of GBPs are capable of bringing together tethered DNA binding domain (DBD) and activation domain (AD) onto the GFP scaffold. Such a complex can then trigger induction of any gene regulated by an upstream activating sequence (UAS).
From the laboratory of Connie L. Cepko, PhD, Harvard University.
Part of The Investigator's Annexe program.
| Product Type: | Plasmid |
| Gene/insert name: | GBP6-p65 transactivation domain (AD) fusion protein |
| Antibiotic Resistance: | Ampicillin |
| Format: | Liquid |
| Tested Applications: | Expression of a GFP-dependent transcription factor component in mammalian cells. For protocols, please see: Tang JC, et al. Cell. 2013 Aug 15;154(4):928-39. |
| Grow in E. coli at 37 C: | Yes |
| Cloning Site 5': | AgeI |
| Cloning Site 3': | NotI |
| 5' Sequencing Primer: | GGACTTCCTTTGTCCCAAATCTG |
| 3' Sequencing Primer: | TAGCCAGAAGTCAGATGCTC |
| Insert Size: | 1011 bp |
| Vector Backbone and Size: | pCAG-GFP, 4823 |
| High or low copy: | High |
| Promoter: | CAG |
| Storage: | Lyophilized DNA is stable at room temperature indefinitely, reconstituted DNA to be stored in 4 degrees short-term, -20 degrees long term. |
| Shipped: | Ambient temperature |
Notes
pCAG-p65AD-GBP6 is a mammalian expression vector designed to express the AD portion of a GFP-dependent transcription factor. Specifically, the p65 AD is linked to the N-terminal end of GBP6. The nuclear localization signal of SV40 large-T antigen is added to the N-terminal of fusion protein. Transcription of the fusion protein is driven by the early CMV enhancer/beta-actin promoter and terminated by a rabbit beta-globin polyadenylation signal. A Kozak consensus sequence (GCCACC) is placed directly in front of the start ATG for enhancing translation efficiency. An ampicillin resistance gene in the plasmid allows for selection in E.coli. The SV40 ori sequence enables episomal replication of the plasmid in cells expressing the SV40 large-T antigen (e.g., 293T and COS-7 cells).
- Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B, Cepko CL. A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
If you publish research with this product, please let us know so we can cite your paper.
